Primers NI-956 and NI-1038 carry out first-round PCR to create a paired-end library that provides guide-to-barcode assignment. The product from this first-round PCR should be amplified using primers that contain the full Illumina P7 flowcell primer sequence, such as the NEBNext Multiplex Oligos for Illumina.
The Illumina TruSeq Read 1 primer site is immediately adjacent to the barcode, and reads the barcode for both assignment and counting libraries. Primer NI-956 adds the Illumina P5 flowcell primer sequence along with the rest of the sequencing primer binding site.
NI-956 5'-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC
…TCAGGCGCGCCACTTCACGCATGCNNNNNNNNNNNNNNNNNNNNNNNNNAGATCGGAAGAGCGTCGTGCTATAGTGAGTCGTATTACATGCTCAAGAGCTCGATCCG…
NI-956 reverse complement <-GATCGGAAGAGCGTCGTG
TAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT
<- Illumina P5
Primer NI-1038 binds in the P(RPR1) promoter, 8 base pairs upstream from the start of the sgRNA. It adds the Illumina TruSeq Read 2 primer site, and the product is then suitable for further amplification with primers containing the Illumina P7 flowcell primer, along with an index if needed. Because the final 8 bases of the P(RPR1) promoter are amplified from the plasmid library, any mutations in these positions will be retained in the final sequencing library.
NI-1038 5'-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTcgaaactctgggagctgc
TruSeq Read #2 primer
…cgcggctgggaacgaaactctgggagctgcgattggcaCATTTCATTACCCGCAGAGCgtttt…
cgaaactctgggagctgc->
GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
In vitro transcription generates an RNA product beginning with the G
nucleotide at the end of the T7 promoter.
templ …AGCTATCAGGCGCGCCACTTCACGCATGCNNNNNNNNNNNNNNNNNNNNNNNNNAGATCGGAAGAGCGTCGTGCTATAGTGAGTCGTATTACATG…
product rev compl …TTCACGCATGCNNNNNNNNNNNNNNNNNNNNNNNNNAGATCGGAAGAGCGTCGTGC
Reverse transcription with NI-1032 generates a fairly short DNA product with a partial Illumina TruSeq Read 2 and flowcell P7 adapter sequence. The product contains the partial Illumina TruSeq Read 1 primer site encoded by the plasmid library as well.
GACGCTCTTCCGATCTNNNNNNNNNNNNNNNNNNNNNNNNNGCATGCGTGAAGTGGCGCGCCTGATAGCTCGTTTAAACTGGGTACCGGCCGCATAGCGAACGTGTAGGGCAGCGTTTCC…
NI-1032 reverse complement <-CTGGGTACCGGCCGCATA
AGATCGGAAGAGCACACGTCTGAA…
PCR using indexed primers such as the NEBNext Multiplex Oligos for Illumina will amplify a sequencing library where the 25-base barcode starts immediately at the beginning of read 1.
i5 AAT…ACAC(i5)ACACTCTTTCCCTACACGACGCTCTTCCGATCT
RT product reverse complement CACGACGCTCTTCCGATCTNN…NNGCA…ATAAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
i7 reverse complement AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC(i7)AT…TG
5'-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTATGCGGCCGGTACCCAGHarvest 1 - 5 × 107 yeast.
Resuspend in 1 ml sterile deionized water, pellet by centrifugation for 30 s at 10,000 × g, and aspirate all water.
Note: Washed yeast pellets can be stored at -80 ºC.
Extract DNA from yeast pellet using the Zymoprep Yeast Plasmid Miniprep II (Zymo Research D2004) according to the manufacturer’s instructions, as described below.
Add 200 µl “Solution 1” to the pellet
Add 3.0 µl Zymolyase to resuspended pellet and mix by mild vortexing
Incubate 1 hour at 37 ºC
Add 200 µl “Solution 2” to the sample
Add 400 µl “Solution 3” to the sample
Centrifuge 3 min at maximum speed (16,000 - 20,000 × g)
Transfer the supernatant to the Zymo-Spin-I column
Spin the column 30 s at 10,000 - 16,000 × g and discard the flow-through
Add 550 µl “Wash Buffer”, spin the column 1 min at 10,000 - 16,000 × g, and discard the flow-through
Transfer the column to a new, clean microcentrifuge tube
Add 10.0 µl Tris•Cl 10 mM, pH 8.0 and centrifuge 1 min at 10,000 - 16,000 × g to collect eluate containing extracted plasmid DNA
Linearize extracted DNA using XhoI (NEB R0146). Combine
| Volume | Reagent | Final |
|---|---|---|
| 10.0 µl | extracted plasmid DNA | |
| 11.5 µl | deionized water | |
| 2.5 µl | 10× CutSmart buffer | 1× |
| 1.0 µl | XhoI 20 U / µl | 20 U |
Incubate 1 hour at 37 ºC
Purify linearized DNA using a DNA Clean & Concentrator-5 (Zymo Research D4013) according to the manufacturer’s instructions, with a 20 µl elution volume.
Prepare an in vitro transcription reaction using the protocol for “short transcripts” in the HiScribe T7 Quick High Yield RNA Synthesis Kit (NEB E2050S). Combine
| Volume | Reagent |
|---|---|
| 18.0 µl | purified, linearized DNA |
| 10.0 µl | NTP buffer mix |
| 2.0 µl | T7 RNA polymerase mix |
Incubate overnight at 37 ºC
Remove template DNA by adding 20.0 µl deionized water and 2.0 µl DNase I, 2 U / µl (provided in the kit) and incubate for 15 minutes at 37 ºC.
Purify IVT product using an RNA Clean & Concentrator-5 (Zymo Research R1013) according to the manufacturer’s instructions, with a 15.0 µl elution volume.
Carry out reverse transcription using 10 ng of purified IVT product and ProtoScript II (NEB M0368S). Combine
| Quantity | Reagent |
|---|---|
| 10 ng | purified IVT product RNA |
| 2.0 µl | NI-1032 at 1 µM |
| 1.0 µl | 10 mM ea. dNTPs |
| x µl | water, to 10.0 µl final volume |
Denature 5 min at 65 ºC and place immediate on ice. Add
| Quantity | Reagent |
|---|---|
| 4.0 µl | 5× ProtoScript II buffer |
| 2.0 µl | 100 mM DTT |
| 1.0 µl | ProtoScript II, 200 U / µl |
| 0.2 µl | RNase inhibitor, 40 U / µl |
Incubate 1 hour at 42 ºC and then heat inactivate 20 min at 65 ºC.
Perform PCR amplification using Q5 master mix (NEB M0492S) and NEBNext Multiplex Oligos for Illumina (Dual Index Primer Set 1, NEB E7600S, or Dual Index Primer Set 2, NEB E7780S). Use distinct i5nn and i7nn primers for each sample – e.g., i501 and i701 for the first sample, i502 and i702 for the second sample, and so forth – in order to exclude index hopping. Combine
| Quantity | Reagent |
|---|---|
| 5.0 µl | Reverse transcription reaction |
| 2.5 µl | NEBNext i5nn primer, 10 µM |
| 2.5 µl | NEBNext i7nn primer, 10 µM |
| 15.0 µl | deionized water |
| 25.0 µl | Q5 High-Fidelity 2× Master Mix |
| Step | Temp | Time | |
|---|---|---|---|
| Initial denaturation | 98 ºC | 30 s | |
| Amplification | 7x | 98 ºC | 5 s |
| 65 ºC | 10 s | ||
| 72 ºC | 10 s | ||
| Final extension | 72 ºC | 2 min |
Purify PCR products using AMpure XP (Beckman Coulter A63880) according to the manufacturer’s instructions, using 100 µl bead suspension for 50 µl PCR (a 2.0:1.0 bead-to-sample ratio). Elute DNA with 20. µl Tris•Cl 10 mM, pH 8.0.
Quantify DNA by UV absorbance (e.g. on a Nanodrop spectrophotometer).
Validate the library using the High Sensitivity D1000 ScreenTape (Agilent), diluting as needed to ensure the ScreenTape sample is <1 ng / µl.
Carry out single-read, dual-indexed Illumina sequencing.